Soman-Induced Neuro-Inflammatory Reaction in Mouse Brain. Some Effects of a Combination of Atropine and Ketamine

Organophosphorus nerve agent (OP) poisoning induces death through different mechanisms including respiratory and cardiovascular major dysfunctions. Epileptic seizures, status epilepticus and seizurerelated brain damage (SRBD) complicate the clinical picture. Recently different publications showed that neuro-inflammatory events take place during OP-induced seizures but their role in SRBD and post-status epilepticus epileptogenesis is not clear. Antagonists of the NMDA ionotropic glutamate receptors are currently the only drugs able to arrest seizures and provide neuroprotection when treatment is initiated up to one hour after poisoning. We recently reported that racemic ketamine, or the more active isomer S(+) ketamine, in combination with atropine sulphate (AS), could counteract lethality, seizures and SRBD in soman poisoned guinea-pigs. Moreover peripheral anti-inflammatory properties of ketamine have been described. To complement former studies restricted to shorter time courses, we undertook a quantitative RT-PCR analysis of the brain genic response to soman (IL-1β, TNFα, IL-6, ICAM-1 and SOCS3) up to 7 days after poisoning in a mouse model of severe convulsions and neuropathy (HI-6, 50 mg/kg i.p. 5 min prior to 172 μg/kg soman, s.c.). Changes in mRNA levels were quantified in hippocampus and cortex. We also assessed 48h post intoxication the effects of two regimens of racemic ketamine combined with AS (10 mg/kg, i.p.) on the mRNA levels of the same genes, on the related protein levels as well as on the protein levels for RANTES and KC, two chemokines, VCAM1 and IL-10. Six injections of a sub-anaesthetic dose (25 mg/kg, i.p.) were performed every half-an-hour starting 30 minutes post-poisoning. When treatment initiation was delayed to 1 h post-challenge, ketamine (100 mg/kg) was injected at 60, 120 and 180 minutes. In response to soman intoxication an important and highly significant increase of the five mRNA levels was recorded in cortex and hippocampus. In the cortex, the activation was generally detected as early as 1 h post-intoxication with a peak response recorded between 6 and 24 h. In the hippocampus, the mRNA increase was delayed to 6 h post-soman and the peak response observed between 24 h and 48 h. After peaking, the response declined (except for ICAM-1 in the hippocampus) but remained elevated, some of them significantly, at day 7. With both treatment regimens, the ketamine-AS combination was able to counteract the changes in mRNA and related proteins provoked by poisoning. In conclusion, the present study indicates a quick neuro-inflammatory gene response that does not subside over 7 days. The effects of ketamine combined with AS on the neuro-inflammation remain to be clearly understood. Dhote, F.; Peinnequin, A.; Carpentier, P.; Baille, V.; Delacour, C.; Foquin, A.; Lallement, G.; Dorandeu, F. (2007) Soman-Induced NeuroInflammatory Reaction in Mouse Brain. Some Effects of a Combination of Atropine and Ketamine. In Defence against the Effects of Chemical Hazards: Toxicology, Diagnosis and Medical Countermeasures (pp. 2-1 – 2-20). Meeting Proceedings RTO-MP-HFM-149, Paper 2. Neuilly-sur-Seine, France: RTO. Available from: http://www.rto.nato.int. Soman-Induced Neuro-Inflammatory Reaction in Mouse Brain. Some Effects of a Combination of Atropine and Ketamine 2 2 RTO-MP-HFM-149 1.0 INTRODUCTION In the chemical warfare arsenal, the organophosphorus (OP) nerve agents (NA) are the most dangerous agents known. They may be feared during combat situations (e.g. Iran-Irak war (1980-1988) and the second Gulf war in 1991), as well as terrorist attacks (Japan, 1994-1995 [1]). They act as potent irreversible inhibitors of cholinesterases (ChEs) in both central (CNS) and peripheral nervous systems and induce an immediate hypercholinergic crisis responsible for most of the pathological responses to the poisoning. Among NA, soman is considered as a major threat, and particularly studied because of the difficulty of the treatment. As with other NA, depending upon the dose, exposure to soman can produce hypersalivation, respiratory distress, cardiovascular dysfunction, coma and rapid death. In the brain, the excess of acetylcholine triggers seizure activity and leads to the secondary recruitment of the excitatory glutamate (Glu) system. Through overstimulation of Glu receptors, including the ionotropic N-methyl-Daspartate (NMDA) receptors, Glu is thought to play a prominent role in the long-lasting maintenance of seizure activity (Status epilepticus, SE) and in the build-up of irreversible seizure-related brain damage (SRBD). When injured the brain is usually the site of an inflammatory reaction that was particularly well studied in acute affections such as cranial trauma, cerebral ischaemia or epilepsy [2, 3]. Inflammation has usually an important repairing function, but frequently in the CNS it rather appears to be the cause of damage and does not fulfil this repairing function [4]. Glial cells (microglia and astrocytes) are key mediators of the immune response in the CNS. Microglia is closely related to macrophages and undergoes dramatic morphological and functional changes after CNS trauma or excitotoxic lesion and can be directly stimulated by excitatory neurotransmitters such as Glu, inducing the production of inflammatory mediators such as cytokines [5]. Amongst inflammatory mediators, pro-inflammatory cytokines (TNFα, IL-1β, IL-6...) play an important role by supporting the activation and/or the proliferation of microglia and astrocytes [6-9]. These effects are counterbalanced by those of other molecules such as IL-10, that has been shown to be neuroprotective against Glu-induced or hypoxic-ischaemic neuronal death [10], or SOCS3 (Suppressor Of Cytokine Stimulating-3). The latter acts as a negative modulator of inflammatory cytokine signalling, including that supported by IL-6 known to increase SOCS3 gene transcription [1113]. SOCS3 mRNA up-regulation can thus be viewed as a marker of the synthesis of such cytokines [13]. Other important players are the adhesion molecules such as ICAM-1 or VCAM-1 and chemokines like KC or RANTES (Regulates upon Activation in Normal T cells Expressed and Secreted) that support the interaction between leukocytes and cerebral vascular endothelium, thus facilitating the penetration of immune cells from the peripheral circulation towards the CNS [14]. In the brain of rodents intoxicated with a convulsive dose of soman, a cellular inflammatory response has been described in the form of an astrocytic and microglial activation lasting for several days and being the most intense between 3 (microglia) and 7 (astroglia) days post-poisoning [15-18]. Some data also suggest a peripheral recruitment of immune cells, a phenomenon of unknown quantitative importance [16, 18]. Other recent studies, restricted to the most acute phase of the intoxication, have shown an early and transitory induction (<48h) of several neuro-inflammatory genes and IL-1β protein [19-21]. Owing to the known relationship between the cellular (glial) and molecular components of neuro-inflammation, the transient gene activation described by these authors appears rather surprising. NA-induced SE becomes rapidly refractory to most of the treatment usually considered and especially to benzodiazepines [22], a property also shared by other types of refractory SE [23]. Antagonists of the NMDA receptors are currently the only drugs able to arrest experimental seizures and provide neuroprotection when treatment is initiated up to one hour after poisoning and beginning of seizures [24, 25]. Ketamine (KET) is one of the very few NMDA antagonists in clinical use. We recently reported that either racemic ketamine (KET), or the more active isomer S(+) KET, in combination with atropine sulphate (AS) could counteract lethality, seizures and SRBD in soman poisoned guinea-pigs even if the treatment initiation was delayed [26, 27]. Reasons for KET efficacy are probably multiple. Efficacy might be based on beneficial effects on cardiovascular or respiratory systems, or because of the NMDA Soman-Induced Neuro-Inflammatory Reaction in Mouse Brain. Some Effects of a Combination of Atropine and Ketamine RTO-MP-HFM-149 2 3 receptor blockade that can stop seizures and be neuroprotective. A NMDA-based primary mechanism was suggested by the results we obtained with S(+) KET. Neuro-inflammation being potentially of great importance for SRBD and epileptogenesis [2, 28, 29], it can also be hypothesized that KET possesses regulating effects on the excessive soman-induced neuro-inflammation through different mechanisms. Seizure control may be one of them. Indeed, using midazolam, the role of seizures in NA-induced CNS inflammation has been suggested by Chapman et al. [30]. However one cannot bring any definite proof using benzodiazepines because they also act on microglial peripheral benzodiazepine receptors [31]. Interestingly, KET also possesses anti-inflammatory properties, that cannot be related to its anti-epileptic efficacy, in various immune cells such as macrophages and other peripheral leukocytes [32, 33], but also in astrocytes and microglial cells stimulated with lipopolysaccharide (LPS) in vitro and in vivo [34]. For all these reasons, we initiated a work in two phases. First, we undertook a quantitative RTPCR analysis of the genic response up to 7 days after intoxication in a mouse model of severe soman poisoning for which neuropathy has recently been described [16]. This time frame covers the onset of the degenerating processes (the first hours), the main phase of lesion maturation and cell death (24-48h) and the delayed period within which the most intense glial reaction can be detected [16, 17]. Following Williams et al. [19] we have quantified the changes in mRNA levels of IL-1β, TNFα, IL-6, and ICAM-1. In addition, we looked at SOCS3 mRNA. These results are currently in press [35]. Second, to evaluate the effects of KET on soman-induced neuro-inflammation, we tested two regimens of racemic KET combined with AS (10 mg/kg, i.p.), first administration of which started either 30 min or 60 min post-toxic exposure. In these conditions and at one set time point only (48h), we performed a quantitative analysis of the genic response (IL-1β, TNFα, IL-6, ICAM-1, SOCS3), and corresponding protein synthesis (except for SOCS3). KC, RANTES and IL-10 protein expression was also studied. We focused on the hippocampus and the cortex, two structures known to be injured during soman-induced seizures. 2.0 MATERIELS & METHODS Soman, >97% pure by gas chromatography, was supplied by the Centre d’Etudes du Bouchet (Vert-Le-Petit, France). The oxime HI-6 (1-2-hydroxy-iminomethyl-1-pyridino-2-oxanopropane) dichloride was a generous gift of DRDC Suffield (Canada). Atropine sulphate (AS) was from Sigma Chemicals (L’Isle d’Abeau Chesnes, France). Ketamine hydrochloride, KET (Ketamine Panpharma®; 5% solution as hydrochloride, Panpharma, Fougères, France) as well as other drugs whenever necessary were diluted in sterile saline immediately prior to their use. 2.1. Animals Adult male Swiss mice (ca. 30 g, Janvier, France) served as subjects. The animals were housed on a 12 h dark/light cycle with light provided between 7 a.m. and 7 p.m. They were given food and water ad libitum. All experiments were approved by our Institutional Animal Care and Research Advisory Committee in accordance with the applicable French and European community regulations. Animals were randomly distributed across the various groups. 2.2 Pre-treatment and poisoning The day of the experiment, mice that were poisoned received an injection of HI-6 (50 mg/kg in saline; 200μl) 5 min prior to the administration of a convulsive dose of soman (172 μg/kg; 0.6 LD50 in the presence of HI-6; 1.6 LD50 in the absence of HI-6; 200μl). Appropriate control groups were constituted, substituting saline to HI-6 or soman (see below). Except for soman that was injected subcutaneously, all drugs were given i.p. This model of intoxication is known to produce convulsive EEG seizures [36], significant neuropathy and good survival in almost all the animals [16]. In absence of EEG in our experimental setting, the clinical state, including the development of convulsions, was continuously Soman-Induced Neuro-Inflammatory Reaction in Mouse Brain. Some Effects of a Combination of Atropine and Ketamine 2 4 RTO-MP-HFM-149 observed for ca. 3 h after soman intoxication and then every hour until the end of the day. All poisoned mice included in the present work showed long-lasting convulsions indicative of development of seizures. For the assessment of KET/AS treatment, animals that did not convulse or demonstrated limited motor signs before KET/AS were excluded from further treatment. 2.3. Soman-induced transcription of selected genes 2.3.1. Time-course study Following exposure to soman (To), animals were decapitated at set time points, viz To + 30 min, 1 h, 2 h, 6 h, 24 h, 48 h and at day (d) 7. Two control groups that were not poisoned but received instead an injection of saline were constituted. They differed by the administration of HI-6 in the “HI-6 control group” and saline in the “no-HI-6 control group”. They were only sampled at 6 h and 24 h post-injection because published work [19] and our pilot experiments (data not shown) both showed a peak of mRNA induction between 6h and 24 h post-soman, depending on the genes studied. 2.3.2. Effects of KET/AS Two groups were constituted, each receiving one of the regimens of racemic KET combined with AS (10 mg/kg). The first group (Soman KET25) received six injections of AS, combined with 25 mg/kg KET every 30 min, starting 30 minutes post-poisoning (Sub-Anaesthetic Protocol). The second group (Soman KET100) received three injections of AS, combined with 100 mg/kg KET, every 60 min, the first injection being delayed by one hour post-poisoning (Anaesthetic Protocol). At difference with the time-course study, animals of the soman group were repeatedly treated with saline/AS (total of 6 injections) in a protocol matching that of the soman KET25 group. AS might indeed have an effect per se [37]. For this study, two control groups were constituted. They were both treated with HI-6, before receiving saline instead of soman and KET/AS treatment. They matched the two KET experimental groups (KET25 control group and KET100 control group). Animals were decapitated 48 h post intoxication. 2.3.3. mRNA quantification After dissection on ice, brain structures (whole cortex and hippocampus) were immediately placed in 1 ml RNALater® (Ambion, Austin, USA) and kept at +4°C for 24 h. Then samples were stored at 20°C until RNA extraction. For RNA isolation, samples were thawed on ice, and isolation was carried out using RNA InstaPur® (Eurogentec, Saraing, Belgium) according to the manufacturer’s instructions. Reverse transcription was performed in a 20 μl final volume containing 1.5 μg RNA, using the Reverse Transcriptase Core Kit® (Eurogentec, Saraing, Belgium) with 500 μM of each oligo d(T) and ribonuclease inhibitor (80 U) according to the manufacturer’s instructions. Oligonucleotide primers were synthesized at Eurogentec (Saraing, Belgium). The primer design and optimization regarding the primer dimmer, the self-priming formation and the primer melting temperature were done with MacVector® software (Accelrys, San Diego, USA). Specificities of the PCR amplification were documented with LightCycler® melting curve analysis. Amplification products obtained were controlled by high performance gel electrophoresis with DNA Lab Chips® (Agilent technologies, USA). Melting peaks obtained either from RT-product or from specific recombinant DNA were identical. The selected forward (F) and reverse (R) primer sequences are listed in Table 1. Soman-Induced Neuro-Inflammatory Reaction in Mouse Brain. Some Effects of a Combination of Atropine and Ketamine RTO-MP-HFM-149 2 5 Table 1 : Sequences of Forward (F) and Reverse (R) primers used for quantitative PCR. HPRT: hypoxanthine phosphoribosyl transferase; CycA: cyclophilin A; ARBP: acidic ribosomal phosphoprotein ; TBP: TATA box Binding Protein Gene Accession Number 5’-3’ sequence Product size (bp) Annealing temperature (°C) HPRT NM_013556 F CTCATGGACTGATTATGGACAGGAC R GCAGGTCAGCAAAGAACTTATAGCC 123 60 CycA NM_009828 F CATCTGCACTGCCAAGACTGAATG R CTTCTTGCTGGTCTTGCCATTCC 127 58 ARBP NM_007475 F GAAAATCTCCAGAGGCACCATTG R TCCCACCTTGTCTCCAGTCTTTATC 70 54 TBP NM_011603 F CGGACAACTGCGTTGATTTTCAG R GAAGCCCAACTTCTGCACAACTC 117 56 IL-1β NM_008361 F GCTGAAAGCTCTCCACCTCAATG R TGTCGTTGCTTGGTTCTCCTTG 88 58 IL-6 NM_031168 F GAGGATACCACTCCCAACAGACC R AAGTGCATCATCGTTGTTCATACA 141 60 TNFα NM_013693 F CATCTTCTCAAAATTCGAGTGACAA R TGGGAGTAGACAAGGTACAACCC 175 60 SOCS3 NM_007707 F CCAGCTCCAGCTTCTTTCAAGTG R GAGAGTCCGCTTGTCAAAGGTATTG 73 60 ICAM-1 NM_010493 F GGGCTGGCATTGTTCTCTAATGTC R GGATGGTAGCTGGAAGATCGAAAG 69 59 The PCR was carried out with the LC Fast Start DNA Master SYBR Green® kit (Roche Applied Science, Mannheim, Germany) using 5 μl of cDNA (equivalent to 40 ng of total RNA) in a final volume of 20 μl, 4 mM MgCl2 and 0.4 μM of each primer (final concentration). The quantitative PCR were performed using a Lightcycler® (Roche Applied Science, Mannheim, Germany) for 45 cycles at 95°C for 20 s (denaturation), 54-60°C for 5 s (annealing temperature, which is primer dependent, Table 1), and a final step of 10 s at 72°C (elongation). Crossing point values were calculated from Lightcycler® Software v.3.5 (Roche Applied Science, Mannheim, Germany) using the second derivative maximum method. Soman-Induced Neuro-Inflammatory Reaction in Mouse Brain. Some Effects of a Combination of Atropine and Ketamine 2 6 RTO-MP-HFM-149 Quantification was achieved using a pool of all the cDNA samples as calibrator [38] according to the comparative threshold cycle method [39]. The relative mRNA values were calculated with the RealQuant® software (Roche Applied Science). For the time course study, we originally used a single internal control gene and mRNA levels were normalized to the corresponding level of HPRT, a commonly used housekeeping gene, which expression does not appear to be significantly altered by seizures (data not shown). To improve quantification in the second study, normalization was performed by using the geometric average of several validated internal control genes: CycA, HPRT, TBP and ARBP for the cortex and CycA, HPRT and TBP for the hippocampus. Expression stability of the potential reference genes was assessed using GENORM software [40]. 2.4. Effects of soman on selected proteins and modification by KET/AS Five out of the seven treatment groups that were used are identical to those previously described in the study of KET/AS effects on soman-induced inflammatory gene transcription. In order to evaluate the potential effects of KET on protein levels, a control group receiving no KET matched the KET100 control group. Finally, HI-6 injection was even omitted in the last control group. Animals were decapitated 48 h post intoxication. After dissection on ice, brain structures (whole cortex and hippocampus) were isolated and frozen on dry ice and stored at -80°C. For analysis, hippocampal and whole cortex samples were respectively thawed in 0.5 ml and 1.0 ml of cell lysis buffer (Cell Lysis Kit #171-304012, Bio-Rad Life Science Group, Marnes-la-Coquette, France) containing a protease inhibitor cocktail (#171-304012; Bio-Rad Life Science Group) and 3 μl of a stock solution containing 500 mM phenylmethylsulfonyl fluoride (#P-7626) in dimethyl sulphoxide (#D2650), both from Sigma (L’Isle d’Abeau Chesnes, France). Then, samples were homogenized with a high-speed Polytron PT3100 (Fischer Scientific, Illkirch, France) at +4°C using four rapid pulses. Samples were then centrifuged at 4500×g for 15 min at +4°C, supernatants collected and stored at -80°C. Total protein concentration was determined using the BCA protein Assay kit (#23225 Pierce; Interchim, Illkirch, France). All tissue samples were diluted with the cell lysis buffer to a final total protein concentration of 1000 μg/ml. Tissue homogenates were assayed for cytokines, chemokines and adhesion molecules using multiplexed bead-based immunoassay kits for IL-1β, IL-6, TNFα, IL-10, KC and RANTES (Bio-Rad Life Science Group) and ICAM-1, VCAM-1 (Millipore Linco Biosciences Division, Saint Quentin en Yvelines, France), according to the manufacturers’ instructions. 2.5. Statistical analysis When multiple groups were compared, a non-parametric procedure was followed: either MannWhitney test (2 groups) or a Kruskal-Wallis ANOVA by ranks followed by post-hoc pairwise comparison with the Mann-Whitney test with Bonferroni correction. Analysis was performed in two steps. First difference between control groups was tested and if not statistically different they were pooled and constituted a single group incorporated in the relevant comparisons with other experimental groups.